arabidopsis thaliana

    Arabidopsis thaliana GudangMovies21 Rebahinxxi LK21

    Arabidopsis thaliana adalah tanaman dari famili Brassicaceae yang dipilih menjadi tanaman yang paling sesuai untuk menjadi model studi perkembangan tanaman. Seluruh materi genetik atau genom tanaman ini telah diketahui melalui proses sekuensing karena tanaman ini dinilai paling cocok menjadi sumber studi informasi genetik tanaman. Pemilihan tanaman ini untuk disekuensing dikarenakan ukuran genomnya yang berkisar 125-130 Mega-pasang-basa (mega base-pair atau mb) merupakan ukuran genom terkecil di antara berbagai tumbuhan tingkat tinggi. A. thaliana cocok digunakan sebagai organisme model untuk mempelajari metabolisme, perkembangan, respons terhadap tekanan, dan ketahanan terhadap penyakit pada semua tanaman berbunga karena siklus hidup A. thaliana pendek (± 60 hari) dan biji yang dihasilkan melimpah.


    Ciri


    Batang A. thaliana memiliki tinggi ±35 cm, bercabang bebas, berwarna hijau, dan pada beberapa bagian nodul berwarna ungu. Bunga terdiri dari 4 kelopak bunga, kepala sari berwarna kuning (panjang 3 mm), ovarium berbentuk silinder, berwarna hijau, dan buah yang akan dihasilkan berukuran ± 2 mm. Tanaman ini berasal dari Eropa dan habitat alaminya berupa tanah pasir, tanah berbatu, pinggir jalan, dan rel kereta api.


    Referensi




    Lihat pula


    Neurita

Kata Kunci Pencarian: arabidopsis thaliana

arabidopsis thalianaarabidopsis thaliana larabidopsis thaliana rootsarabidopsis thaliana nama indonesiaarabidopsis thaliana common namearabidopsis thaliana embryogenesisarabidopsis thaliana monocot or dicotarabidopsis thaliana genomearabidopsis thaliana genome sizearabidopsis thaliana life cycle Search Results

arabidopsis thaliana

Daftar Isi

Solved Arabidopsis thaliana is a green-leafed plant, but a - Chegg

Arabidopsis thaliana is a green-leafed plant, but a variegated type has green-and-yellow leaves. STATE: To investigate the mechanism of plant variegation, researchers created a recessive mutation that suppresses variegation in the DNA of the variegated Arabidopsis.

Solved Why is Arabidopsis thaliana a good research tool? - Chegg

Why is Arabidopsis thaliana a good research tool? Select all that apply. It has a large, haploid genome that has been completely sequenced since 2000. Self pollination (hermaphroditic) It has prolific seed production. It is easy to cultivate The genetic and physical maps of all 5 chromosomes are not yet complete. It has a rapid life cycle.

Solved Arabidopsis thaliana (A. thaliana) is a small plant - Chegg

Arabidopsis thaliana (A. thaliana) is a small plant from the mustard family that is used in biological research. Which of the following statement would be true of A. thaliana? Select all that apply. A. thaliana releases oxygen as a byproduct when it makes its food, glucose.

Solved 22. In the plant Arabidopsis thaliana, a geneticist - Chegg

In the plant Arabidopsis thaliana, a geneticist is interested in the development of trichomes (small projections) on the leaves. A large screen turns up two mutant plants (A and B) that have no trichomes, and these mutants seem to be potentially useful in studying trichome development (if they are determined by single-gene mutations, then ...

Solved In Arabidopsis thaliana, the Flowering Locus C (FLC)

In Arabidopsis thaliana, the Flowering Locus C (FLC) gene codes for a regulatory protein that suppresses flowering. FLC is expressed in seedlings to prevent premature flowering. In mature plants, FLC expression decreases with cooler temperatures, and flowering occurs once sufficiently cool temperatures are reached.

Solved Arabidopsis thaliana is a common weed that serves as

Question: Arabidopsis thaliana is a common weed that serves as an experimental model organism because a. it can withstand extremely cold climates. Obit both reproduces in 8-10 weeks and produces thousands of offspring per plant.

Solved Two accessions of Arabidopsis thaliana have different

Question: Two accessions of Arabidopsis thaliana have different phenotypes associated with flowering time. Researchers sequence several genes controlling flower time and, in one of them, find the following differences between two accessions: Sequence 1: ATCGTACGATGCTAGCTTACGTAGCATGAC Sequence 2: …

Solved Several botanists are studying the effect of high - Chegg

Question: Several botanists are studying the effect of high temperature on chloroplast function in Arabidopsis thaliana, a species of flowering plant. The botanists find that extremely high temperatures damage the membrane of the chloroplasts. This causes the contents of the chloroplasts to leak into the cytosol, which makes them nonfunctional.

Solved The figure below depicts the start of the cDNA - Chegg

The figure below depicts the start of the cDNA sequence of the gene AGAMOUS from the model plant Arabidopsis thaliana. ORIGIN 1 ctasatgtactgaasaga caccagttta attaattata ottocatcat atatasctat 61 caaccaagta casactttt gtcaattete aaaatcaact ttcaccacat sattatotas 121 catatatatg ttocasaco agittaaata vaattacket teagasta catatatatt 181 aactctatet ...

Solved Phosphorous (P) is an important nutrient for plant - Chegg

Question: Phosphorous (P) is an important nutrient for plant growth. In an experiment, Arabidopsis thaliana plants grown under phosphorus‐sufficient and phosphorus‐starved conditions for six weeks were observed. At the end of six weeks it was found that the plants grown under phosphorus-starved conditions were much smaller overall.